v3 western blot imager Search Results


99
LI-COR odyssey v3 0
Odyssey V3 0, supplied by LI-COR, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/odyssey v3 0/product/LI-COR
Average 99 stars, based on 1 article reviews
odyssey v3 0 - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

90
Bio-Rad image lab version 6.1.0
Image Lab Version 6.1.0, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/image lab version 6.1.0/product/Bio-Rad
Average 90 stars, based on 1 article reviews
image lab version 6.1.0 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Cellular Technology Ltd image analyzer software v3.2
Image Analyzer Software V3.2, supplied by Cellular Technology Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/image analyzer software v3.2/product/Cellular Technology Ltd
Average 90 stars, based on 1 article reviews
image analyzer software v3.2 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Bio-Rad chemidoc imager
Chemidoc Imager, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chemidoc imager/product/Bio-Rad
Average 90 stars, based on 1 article reviews
chemidoc imager - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Bio-Rad v3 western blot imager
V3 Western Blot Imager, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/v3 western blot imager/product/Bio-Rad
Average 90 stars, based on 1 article reviews
v3 western blot imager - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

94
R&D Systems cd44v6
BMP7 is confined to differentiated CRC cells. a Immunofluorescence analysis of BMP7 (green color) and LGR5 (red color) on peritumoral mucosa and colon cancer paraffin-embedded tissues performed on CSC#8. One representative tumor from twenty different tumors examined is shown. Nuclei were counterstained by Toto-3 (blue color). White arrowheads indicate LGR5 + cells at the base of colon crypt. The scale bar represents 100 µm. b Immunohistochemical analysis of BMP7 on CRC TMAs in lack, low, medium, and high staining intensity (red color). Nuclei were counterstained by aqueous hematoxylin (blue color). The scale bar represents 100 µm. c Association of BMP7 expression with score medium/high and the pathological grading in CRC TMAs provided by TRISTAR technology group. d Immunohistochemical analysis of BMP7 (red color) in paraffin-embedded sections of colon adenomas and adenocarcinoma (COAD). Nuclei were counterstained by aqueous hematoxylin (blue color). The scale bar represents 100 µm. e Immunofluorescence analysis of BMP7 (green color) in CRC sphere cells and their differentiated progeny SDACs. One representative of fifteen different CR-CSC lines (CSC#1–3, 5–7, 10,11, 14–16, 18, 25, 33, and 40) is shown. Nuclei were counterstained by Toto-3 (blue color). The scale bars represent 20 µm. f Representative flow cytometry analysis of CD133 in CRC sphere cells and its relative isotype-matched control (IMC) (upper panels) performed on CSC#4, 8, and 23–26. Immunofluorescence analysis of BMP7 (green color) in CD133 + and CD133 − enriched CRC sphere cell subpopulations (lower panels). Nuclei were counterstained by Toto-3 (blue color). The scale bars represent 20 µm. g <t>CD44v6</t> expression profiles of cells as described in f (upper panels). Expression of BMP7 (green color) in CD44v6 + and CD44v6 − enriched CRC sphere cell subpopulations assessed by immunofluorescence analysis (lower panels). Nuclei were counterstained by Toto-3 (blue color). The scale bars represent 20 µm. h Flow cytometry analysis of BMP7 (green histograms) in enriched CD44v6 − /CD133 − , CD44v6 − /CD133 + , and CD44v6 + /CD133 + CRC subpopulations performed as shown in f . Dotted line histograms indicate the relative IMC
Cd44v6, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cd44v6/product/R&D Systems
Average 94 stars, based on 1 article reviews
cd44v6 - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

95
Danaher Inc hifi cas9 nuclease v3
Endogenous IFI16 inhibits HIV-1 in primary CD4 + T lymphocytes. Cells from three healthy donors were isolated and activated with IL-2 and anti-CD3/CD28 beads. 72 hours post-activation, cells were transfected with <t>Cas9</t> in complex with either a non-targeting (nt) or an IFI16-specific gRNA. At 96 hours post-transfection, cells were transduced with the indicated VSV-G pseudotyped HIV-1 strains. (A-D) The reduction of IFI16 protein levels in infected cell cultures (A), the infectious virus yield (B), p24 antigen production (C) and levels of viral RNA transcripts (D) were determined by Western blot, TZM-bl infection assay, ELISA and qRT-PCR, respectively, three days post infection. Bar diagrams in panel A and D show mean values (±SD) of the three different donors; those in panel B and C from triplicate measurements. Numbers above bars indicate n-fold change between cells treated with control or IFI16 specific gRNA. * p <0.05, ** p <0.01, *** p <0.001. (E) Association of Sp1 and IFI16 by in situ PLA. (F) Sp1 co-precipitates with IFI16 and PYHIN in CD4 + T lymphocytes. Cells from three healthy donors were isolated and activated with IL-2 and anti-CD3/CD28 beads. 72 hours post activation, cells were lysed and endogenous Sp1 was immunoprecipitated using magnetic beads coated with either an Sp1 antibody or control IgG. Co-IP eluates and input controls were subsequently analysed by Western Blotting. Shown is the blot of one representative experiment. On the right-hand panel, the IFI16 signal intensity from three independent experiment (±SEM) is shown.
Hifi Cas9 Nuclease V3, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hifi cas9 nuclease v3/product/Danaher Inc
Average 95 stars, based on 1 article reviews
hifi cas9 nuclease v3 - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

99
Illumina Inc r400697 miseq reagent kit v3 150 cycle
Endogenous IFI16 inhibits HIV-1 in primary CD4 + T lymphocytes. Cells from three healthy donors were isolated and activated with IL-2 and anti-CD3/CD28 beads. 72 hours post-activation, cells were transfected with <t>Cas9</t> in complex with either a non-targeting (nt) or an IFI16-specific gRNA. At 96 hours post-transfection, cells were transduced with the indicated VSV-G pseudotyped HIV-1 strains. (A-D) The reduction of IFI16 protein levels in infected cell cultures (A), the infectious virus yield (B), p24 antigen production (C) and levels of viral RNA transcripts (D) were determined by Western blot, TZM-bl infection assay, ELISA and qRT-PCR, respectively, three days post infection. Bar diagrams in panel A and D show mean values (±SD) of the three different donors; those in panel B and C from triplicate measurements. Numbers above bars indicate n-fold change between cells treated with control or IFI16 specific gRNA. * p <0.05, ** p <0.01, *** p <0.001. (E) Association of Sp1 and IFI16 by in situ PLA. (F) Sp1 co-precipitates with IFI16 and PYHIN in CD4 + T lymphocytes. Cells from three healthy donors were isolated and activated with IL-2 and anti-CD3/CD28 beads. 72 hours post activation, cells were lysed and endogenous Sp1 was immunoprecipitated using magnetic beads coated with either an Sp1 antibody or control IgG. Co-IP eluates and input controls were subsequently analysed by Western Blotting. Shown is the blot of one representative experiment. On the right-hand panel, the IFI16 signal intensity from three independent experiment (±SEM) is shown.
R400697 Miseq Reagent Kit V3 150 Cycle, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/r400697 miseq reagent kit v3 150 cycle/product/Illumina Inc
Average 99 stars, based on 1 article reviews
r400697 miseq reagent kit v3 150 cycle - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

90
Bio-Rad v3 western workflow ™
Endogenous IFI16 inhibits HIV-1 in primary CD4 + T lymphocytes. Cells from three healthy donors were isolated and activated with IL-2 and anti-CD3/CD28 beads. 72 hours post-activation, cells were transfected with <t>Cas9</t> in complex with either a non-targeting (nt) or an IFI16-specific gRNA. At 96 hours post-transfection, cells were transduced with the indicated VSV-G pseudotyped HIV-1 strains. (A-D) The reduction of IFI16 protein levels in infected cell cultures (A), the infectious virus yield (B), p24 antigen production (C) and levels of viral RNA transcripts (D) were determined by Western blot, TZM-bl infection assay, ELISA and qRT-PCR, respectively, three days post infection. Bar diagrams in panel A and D show mean values (±SD) of the three different donors; those in panel B and C from triplicate measurements. Numbers above bars indicate n-fold change between cells treated with control or IFI16 specific gRNA. * p <0.05, ** p <0.01, *** p <0.001. (E) Association of Sp1 and IFI16 by in situ PLA. (F) Sp1 co-precipitates with IFI16 and PYHIN in CD4 + T lymphocytes. Cells from three healthy donors were isolated and activated with IL-2 and anti-CD3/CD28 beads. 72 hours post activation, cells were lysed and endogenous Sp1 was immunoprecipitated using magnetic beads coated with either an Sp1 antibody or control IgG. Co-IP eluates and input controls were subsequently analysed by Western Blotting. Shown is the blot of one representative experiment. On the right-hand panel, the IFI16 signal intensity from three independent experiment (±SEM) is shown.
V3 Western Workflow ™, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/v3 western workflow ™/product/Bio-Rad
Average 90 stars, based on 1 article reviews
v3 western workflow ™ - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

86
LI-COR image studio v3 1
Analysis of NS5A protein expression for threonine mutants. Huh7 cells were electroporated with in vitro transcripts of either (a) mSGR-luc-JFH-1 or (b) mJFH-1 containing the indicated mutants, cells were lysed at 48 hpe and analysed by Western blot with sheep polyclonal anti-NS5A serum or anti-actin as the loading control. Western blots were quantified using Image Studio <t>v3.1</t> (LI-COR). Data from three independent experiments are shown and error bars represent the standard error of the mean.
Image Studio V3 1, supplied by LI-COR, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/image studio v3 1/product/LI-COR
Average 86 stars, based on 1 article reviews
image studio v3 1 - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

98
LI-COR image studio software
Analysis of NS5A protein expression for threonine mutants. Huh7 cells were electroporated with in vitro transcripts of either (a) mSGR-luc-JFH-1 or (b) mJFH-1 containing the indicated mutants, cells were lysed at 48 hpe and analysed by Western blot with sheep polyclonal anti-NS5A serum or anti-actin as the loading control. Western blots were quantified using Image Studio <t>v3.1</t> (LI-COR). Data from three independent experiments are shown and error bars represent the standard error of the mean.
Image Studio Software, supplied by LI-COR, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/image studio software/product/LI-COR
Average 98 stars, based on 1 article reviews
image studio software - by Bioz Stars, 2026-04
98/100 stars
  Buy from Supplier

90
Danaher Inc deltavision omx v3 imaging system
Analysis of NS5A protein expression for threonine mutants. Huh7 cells were electroporated with in vitro transcripts of either (a) mSGR-luc-JFH-1 or (b) mJFH-1 containing the indicated mutants, cells were lysed at 48 hpe and analysed by Western blot with sheep polyclonal anti-NS5A serum or anti-actin as the loading control. Western blots were quantified using Image Studio <t>v3.1</t> (LI-COR). Data from three independent experiments are shown and error bars represent the standard error of the mean.
Deltavision Omx V3 Imaging System, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/deltavision omx v3 imaging system/product/Danaher Inc
Average 90 stars, based on 1 article reviews
deltavision omx v3 imaging system - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


BMP7 is confined to differentiated CRC cells. a Immunofluorescence analysis of BMP7 (green color) and LGR5 (red color) on peritumoral mucosa and colon cancer paraffin-embedded tissues performed on CSC#8. One representative tumor from twenty different tumors examined is shown. Nuclei were counterstained by Toto-3 (blue color). White arrowheads indicate LGR5 + cells at the base of colon crypt. The scale bar represents 100 µm. b Immunohistochemical analysis of BMP7 on CRC TMAs in lack, low, medium, and high staining intensity (red color). Nuclei were counterstained by aqueous hematoxylin (blue color). The scale bar represents 100 µm. c Association of BMP7 expression with score medium/high and the pathological grading in CRC TMAs provided by TRISTAR technology group. d Immunohistochemical analysis of BMP7 (red color) in paraffin-embedded sections of colon adenomas and adenocarcinoma (COAD). Nuclei were counterstained by aqueous hematoxylin (blue color). The scale bar represents 100 µm. e Immunofluorescence analysis of BMP7 (green color) in CRC sphere cells and their differentiated progeny SDACs. One representative of fifteen different CR-CSC lines (CSC#1–3, 5–7, 10,11, 14–16, 18, 25, 33, and 40) is shown. Nuclei were counterstained by Toto-3 (blue color). The scale bars represent 20 µm. f Representative flow cytometry analysis of CD133 in CRC sphere cells and its relative isotype-matched control (IMC) (upper panels) performed on CSC#4, 8, and 23–26. Immunofluorescence analysis of BMP7 (green color) in CD133 + and CD133 − enriched CRC sphere cell subpopulations (lower panels). Nuclei were counterstained by Toto-3 (blue color). The scale bars represent 20 µm. g CD44v6 expression profiles of cells as described in f (upper panels). Expression of BMP7 (green color) in CD44v6 + and CD44v6 − enriched CRC sphere cell subpopulations assessed by immunofluorescence analysis (lower panels). Nuclei were counterstained by Toto-3 (blue color). The scale bars represent 20 µm. h Flow cytometry analysis of BMP7 (green histograms) in enriched CD44v6 − /CD133 − , CD44v6 − /CD133 + , and CD44v6 + /CD133 + CRC subpopulations performed as shown in f . Dotted line histograms indicate the relative IMC

Journal: Oncogene

Article Title: Targeting chemoresistant colorectal cancer via systemic administration of a BMP7 variant

doi: 10.1038/s41388-019-1047-4

Figure Lengend Snippet: BMP7 is confined to differentiated CRC cells. a Immunofluorescence analysis of BMP7 (green color) and LGR5 (red color) on peritumoral mucosa and colon cancer paraffin-embedded tissues performed on CSC#8. One representative tumor from twenty different tumors examined is shown. Nuclei were counterstained by Toto-3 (blue color). White arrowheads indicate LGR5 + cells at the base of colon crypt. The scale bar represents 100 µm. b Immunohistochemical analysis of BMP7 on CRC TMAs in lack, low, medium, and high staining intensity (red color). Nuclei were counterstained by aqueous hematoxylin (blue color). The scale bar represents 100 µm. c Association of BMP7 expression with score medium/high and the pathological grading in CRC TMAs provided by TRISTAR technology group. d Immunohistochemical analysis of BMP7 (red color) in paraffin-embedded sections of colon adenomas and adenocarcinoma (COAD). Nuclei were counterstained by aqueous hematoxylin (blue color). The scale bar represents 100 µm. e Immunofluorescence analysis of BMP7 (green color) in CRC sphere cells and their differentiated progeny SDACs. One representative of fifteen different CR-CSC lines (CSC#1–3, 5–7, 10,11, 14–16, 18, 25, 33, and 40) is shown. Nuclei were counterstained by Toto-3 (blue color). The scale bars represent 20 µm. f Representative flow cytometry analysis of CD133 in CRC sphere cells and its relative isotype-matched control (IMC) (upper panels) performed on CSC#4, 8, and 23–26. Immunofluorescence analysis of BMP7 (green color) in CD133 + and CD133 − enriched CRC sphere cell subpopulations (lower panels). Nuclei were counterstained by Toto-3 (blue color). The scale bars represent 20 µm. g CD44v6 expression profiles of cells as described in f (upper panels). Expression of BMP7 (green color) in CD44v6 + and CD44v6 − enriched CRC sphere cell subpopulations assessed by immunofluorescence analysis (lower panels). Nuclei were counterstained by Toto-3 (blue color). The scale bars represent 20 µm. h Flow cytometry analysis of BMP7 (green histograms) in enriched CD44v6 − /CD133 − , CD44v6 − /CD133 + , and CD44v6 + /CD133 + CRC subpopulations performed as shown in f . Dotted line histograms indicate the relative IMC

Article Snippet: Following blocking with 3% bovine serum albumin (BSA) for 30 min, cells were exposed overnight at 4 °C to BMP7 (MAB3541, mouse, IgG2 b , R&D system), LGR5 (GPR49, rabbit, IgG, Abgent), CDX2 (MAB3665, mouse, IgG1, R&D Systems), CK20 (NCL-L-CK20, mouse, IgG2 k , Novocastra Leica), E-cadherin (#3195, rabbit, IgG, CST), vimentin (#5741, rabbit, IgG, CST), β-catenin (MAB1329, mouse, IgG2 b , R&D Systems), CD44v6 (BBA13, clone 2F10, mouse, IgG1, R&D system), BMPR1A (MAB2406, mouse, IgG2 b , R&D Systems), BMPR1B (MAB505, mouse, IgG2 a , R&D Systems) and, BMPR2 (MAB811, mouse, IgG2 b , R&D Systems) antibodies or isotype-matched controls (IMCs).

Techniques: Immunofluorescence, Immunohistochemical staining, Staining, Expressing, Flow Cytometry, Control

BMP7v treatment promotes CR-CSC differentiation. a Phase-contrast microscopy analysis of CD44v6 + CRC sphere cells treated with BMP7v at the indicated time points. One representative of CSC#1, 2, 4, 5, 7, and 23–26 is shown. The scale bar represents 20 µm. b Percentage of CK20 positive cells in CD44v6 + CR-CSCs treated with vehicle or BMP7v up to 21 days evaluated by immunofluorescence analysis. Data are expressed as mean ± SD of experiments performed in 15 CRC sphere cell lines (CSC#1–3, 5–7, 10,11, 14–16, 18, 25, 33, and 40). c Flow cytometry analysis of CD133/CD44v6 on CRC sphere cells treated with vehicle or BMP7v for 14 days. Data reported are mean ± SD of 15 CRC sphere cell lines analyzed (CSC#1–8, 10,11, 14–16, 18, and 25). d (left panels) Immunofluorescence analysis of CDX2 on CR-CSCs upon 14 days of BMP7v treatment. One representative of CSC# 3, 9, and 21 is shown. Nuclei were stained with Toto-3 (blue color). The scale bars represent 20 µm. (right panel) Percentage of CDX2 positive cells in CD44v6 + CR-CSCs treated with vehicle or BMP7v up to 14 days evaluated by immunofluorescence analysis. Data are expressed as mean ± SD of experiments performed in CSC# 3, 9, and 21. e Flow cytometry analysis of TOP-dGFP or CD44v6 in enriched CD44v6 + sphere cells treated with BMP7v up to 14 days. One representative experiment of CSC#1, 2, 4, 7, and 10 is shown. f Phase-contrast microscopy analysis of TOP-dGFP CRC sphere cells grown in matrigel drops and treated with vehicle, BMP7v or FBS for 14 days. One representative of CSC# 8, 9, and 11 is shown. The scale bar represents 100 µm. g Immunofluorescence analysis of E-cadherin, vimentin, and β-catenin (green color) in CD44v6 + CRC cells exposed to vehicle or BMP7v for 14 days. One representative experiment performed in cells as in e is shown. Nuclei were stained with Toto-3 (blue color). The scale bars represent 20 µm. h Migrating CD44v6 + and CD44v6 − cells treated with vehicle or BMP7v up to 48 h. Data are shown as mean ± SD of three independent experiments performed in five CRC sphere cell lines (CSC#1, 5, 7, 10, and 12). i Cell viability percentage of enriched CD44v6 + and CD44v6 − cells treated with vehicle or BMP7v up to 96 h. Data are shown as mean ± SD of different experiments performed in CSC#1, 2, 4, 7, and 10. j Cell cycle analysis in CD44v6 + CR-CSCs exposed to vehicle or BMP7v for 72 h. The data show percentage of cell number in sub-G0, G0/G1, S, and G2/M phases. Data are expressed as mean ± SD of three independent experiments performed in five different CRC sphere cell lines as in e . k Immunoblot analysis of PARP, cleaved PARP (cPARP), Caspase-3 (Casp-3), cleaved Caspase-3 (cCasp-3), Bcl-2, Bcl-xL in CD44v6 + , and CD44v6 − enriched cells treated as in e for 72 h. β-actin was used as loading control. One representative experiment performed in three different CRC sphere cell lines (CSC#1, 4, and 7)

Journal: Oncogene

Article Title: Targeting chemoresistant colorectal cancer via systemic administration of a BMP7 variant

doi: 10.1038/s41388-019-1047-4

Figure Lengend Snippet: BMP7v treatment promotes CR-CSC differentiation. a Phase-contrast microscopy analysis of CD44v6 + CRC sphere cells treated with BMP7v at the indicated time points. One representative of CSC#1, 2, 4, 5, 7, and 23–26 is shown. The scale bar represents 20 µm. b Percentage of CK20 positive cells in CD44v6 + CR-CSCs treated with vehicle or BMP7v up to 21 days evaluated by immunofluorescence analysis. Data are expressed as mean ± SD of experiments performed in 15 CRC sphere cell lines (CSC#1–3, 5–7, 10,11, 14–16, 18, 25, 33, and 40). c Flow cytometry analysis of CD133/CD44v6 on CRC sphere cells treated with vehicle or BMP7v for 14 days. Data reported are mean ± SD of 15 CRC sphere cell lines analyzed (CSC#1–8, 10,11, 14–16, 18, and 25). d (left panels) Immunofluorescence analysis of CDX2 on CR-CSCs upon 14 days of BMP7v treatment. One representative of CSC# 3, 9, and 21 is shown. Nuclei were stained with Toto-3 (blue color). The scale bars represent 20 µm. (right panel) Percentage of CDX2 positive cells in CD44v6 + CR-CSCs treated with vehicle or BMP7v up to 14 days evaluated by immunofluorescence analysis. Data are expressed as mean ± SD of experiments performed in CSC# 3, 9, and 21. e Flow cytometry analysis of TOP-dGFP or CD44v6 in enriched CD44v6 + sphere cells treated with BMP7v up to 14 days. One representative experiment of CSC#1, 2, 4, 7, and 10 is shown. f Phase-contrast microscopy analysis of TOP-dGFP CRC sphere cells grown in matrigel drops and treated with vehicle, BMP7v or FBS for 14 days. One representative of CSC# 8, 9, and 11 is shown. The scale bar represents 100 µm. g Immunofluorescence analysis of E-cadherin, vimentin, and β-catenin (green color) in CD44v6 + CRC cells exposed to vehicle or BMP7v for 14 days. One representative experiment performed in cells as in e is shown. Nuclei were stained with Toto-3 (blue color). The scale bars represent 20 µm. h Migrating CD44v6 + and CD44v6 − cells treated with vehicle or BMP7v up to 48 h. Data are shown as mean ± SD of three independent experiments performed in five CRC sphere cell lines (CSC#1, 5, 7, 10, and 12). i Cell viability percentage of enriched CD44v6 + and CD44v6 − cells treated with vehicle or BMP7v up to 96 h. Data are shown as mean ± SD of different experiments performed in CSC#1, 2, 4, 7, and 10. j Cell cycle analysis in CD44v6 + CR-CSCs exposed to vehicle or BMP7v for 72 h. The data show percentage of cell number in sub-G0, G0/G1, S, and G2/M phases. Data are expressed as mean ± SD of three independent experiments performed in five different CRC sphere cell lines as in e . k Immunoblot analysis of PARP, cleaved PARP (cPARP), Caspase-3 (Casp-3), cleaved Caspase-3 (cCasp-3), Bcl-2, Bcl-xL in CD44v6 + , and CD44v6 − enriched cells treated as in e for 72 h. β-actin was used as loading control. One representative experiment performed in three different CRC sphere cell lines (CSC#1, 4, and 7)

Article Snippet: Following blocking with 3% bovine serum albumin (BSA) for 30 min, cells were exposed overnight at 4 °C to BMP7 (MAB3541, mouse, IgG2 b , R&D system), LGR5 (GPR49, rabbit, IgG, Abgent), CDX2 (MAB3665, mouse, IgG1, R&D Systems), CK20 (NCL-L-CK20, mouse, IgG2 k , Novocastra Leica), E-cadherin (#3195, rabbit, IgG, CST), vimentin (#5741, rabbit, IgG, CST), β-catenin (MAB1329, mouse, IgG2 b , R&D Systems), CD44v6 (BBA13, clone 2F10, mouse, IgG1, R&D system), BMPR1A (MAB2406, mouse, IgG2 b , R&D Systems), BMPR1B (MAB505, mouse, IgG2 a , R&D Systems) and, BMPR2 (MAB811, mouse, IgG2 b , R&D Systems) antibodies or isotype-matched controls (IMCs).

Techniques: Microscopy, Immunofluorescence, Flow Cytometry, Staining, Cell Cycle Assay, Western Blot, Control

BMP7v hampers the self-renewal and recapitulates a CD44v6 − -like cell subpopulation profile. a Colony forming efficiency percentage of CD44v6 + CR-CSCs treated for 14 days with vehicle, gremlin or noggin alone or in combination with BMP4 or BMP7v. Data are reported as mean ± SD of five different CRC sphere cell lines analyzed (CSC#1, 2, 4, 7, and 10). Representative soft-agar analysis is shown in the lower part of graph. b Heat map of EMT-, tumor metastasis-, and Wnt pathway-related genes (2 −ΔΔCt expression values) in spheres, CD44v6 − and CD44v6 + cells. Data are presented as normalized expression values of three different CRC sphere cell lines (CSC#4, 8, and 18). c Log fold change (logFC) values of differentially expressed related genes in enriched CD44v6 + cells treated with BMP7v for 3 days. Data are presented as the average of normalized mRNA expression levels of four different CR-CSC lines (CSC#1, 3, 5, and 7). Dotted lines represent −1 and 1 logFC values. P value indicates difference between normalized mRNA expression levels of untreated vs BMP7v treated samples. d Venn diagram showing upregulated (red) and e downregulated (green) genes in CD44v6 − and BMP7v treated cells. (Lower panels) Top ten significantly enriched gene sets (FDR q value ≤ 0.05), selected by using Hallmark, KEGG, and GO, related to the indicated 7 up- and 48 down-regulated genes common in CD44v6 − cells and CD44v6 + cells treated with BMP7v. P values related to each enriched gene set are indicated. f Fold change values of the differentially upregulated (red) and downregulated (green) genes further validated by RT-PCR in CR-CSCs upon treatment with BMP7v for 72 h. Data are expressed as mean ± SD of experiments performed in CSC# 1, 3, 9, and 21

Journal: Oncogene

Article Title: Targeting chemoresistant colorectal cancer via systemic administration of a BMP7 variant

doi: 10.1038/s41388-019-1047-4

Figure Lengend Snippet: BMP7v hampers the self-renewal and recapitulates a CD44v6 − -like cell subpopulation profile. a Colony forming efficiency percentage of CD44v6 + CR-CSCs treated for 14 days with vehicle, gremlin or noggin alone or in combination with BMP4 or BMP7v. Data are reported as mean ± SD of five different CRC sphere cell lines analyzed (CSC#1, 2, 4, 7, and 10). Representative soft-agar analysis is shown in the lower part of graph. b Heat map of EMT-, tumor metastasis-, and Wnt pathway-related genes (2 −ΔΔCt expression values) in spheres, CD44v6 − and CD44v6 + cells. Data are presented as normalized expression values of three different CRC sphere cell lines (CSC#4, 8, and 18). c Log fold change (logFC) values of differentially expressed related genes in enriched CD44v6 + cells treated with BMP7v for 3 days. Data are presented as the average of normalized mRNA expression levels of four different CR-CSC lines (CSC#1, 3, 5, and 7). Dotted lines represent −1 and 1 logFC values. P value indicates difference between normalized mRNA expression levels of untreated vs BMP7v treated samples. d Venn diagram showing upregulated (red) and e downregulated (green) genes in CD44v6 − and BMP7v treated cells. (Lower panels) Top ten significantly enriched gene sets (FDR q value ≤ 0.05), selected by using Hallmark, KEGG, and GO, related to the indicated 7 up- and 48 down-regulated genes common in CD44v6 − cells and CD44v6 + cells treated with BMP7v. P values related to each enriched gene set are indicated. f Fold change values of the differentially upregulated (red) and downregulated (green) genes further validated by RT-PCR in CR-CSCs upon treatment with BMP7v for 72 h. Data are expressed as mean ± SD of experiments performed in CSC# 1, 3, 9, and 21

Article Snippet: Following blocking with 3% bovine serum albumin (BSA) for 30 min, cells were exposed overnight at 4 °C to BMP7 (MAB3541, mouse, IgG2 b , R&D system), LGR5 (GPR49, rabbit, IgG, Abgent), CDX2 (MAB3665, mouse, IgG1, R&D Systems), CK20 (NCL-L-CK20, mouse, IgG2 k , Novocastra Leica), E-cadherin (#3195, rabbit, IgG, CST), vimentin (#5741, rabbit, IgG, CST), β-catenin (MAB1329, mouse, IgG2 b , R&D Systems), CD44v6 (BBA13, clone 2F10, mouse, IgG1, R&D system), BMPR1A (MAB2406, mouse, IgG2 b , R&D Systems), BMPR1B (MAB505, mouse, IgG2 a , R&D Systems) and, BMPR2 (MAB811, mouse, IgG2 b , R&D Systems) antibodies or isotype-matched controls (IMCs).

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction

BMP7v exerts antiangiogenic effects and sensitizes chemoresistant CSCs to standard therapy. a Azan-Mallory staining on paraffin-embedded sections of xenografts derived from the injection of CRC sphere cells and treated for 4 weeks (6–9 weeks) with PBS (vehicle) or BMP7v. Data are representative of three independent experiments using different CRC sphere cell lines (CSC#2, 7, and 18). b Percentage of necrosis evaluated on paraffin-embedded sections of xenografts treated as in a . Data are shown as mean ± SD of three independent experiments. c Immunohistochemical analysis of CD31 and VEGFR2 (red staining) on paraffin-embedded sections of xenografts generated by the injection of CRC sphere cell lines and treated with PBS (vehicle), BMP4, or BMP7v. Green arrowheads indicate microvessels expressing CD31 or VEGFR2. Images are representative of three independent experiments using cells as in a . Nuclei were revealed by hematoxylin staining (blue). The scale bar represents 20 µm. d Number of microvessels positive for CD31 (left panel) and VEGFR2 (right panel) expression, evaluated on paraffin-embedded sections of xenografts treated as in c . Data are shown as mean ± SD of cells. MVD = microvessel density. e Fold change of viable cells in 35 CR-CSC lines treated with oxaliplatin/5-FU for 24 h. Dotted line indicates the threshold between chemoresistant (red) and sensitive CR-CSCs (green). f Cell viability percentage in chemoresistant CR-CSCs (R1-R4) pretreated with BMP7 for 3 days and with oxaliplatin/5-FU (oxa/5-FU) for additional 24 h as indicated. Data are shown as mean ± SD of three different experiments performed in the indicated R-CSCs. g Colony forming efficiency of CR-CSCs treated as in f and evaluated at 21 days. Representative soft-agar analyses are reported in the lower part of the graph. Bars show the mean ± SD of seven different CRC sphere cell lines (CSC#1–3, 5, 7, 10, and 18). h Tumor size of subcutaneous growth of the indicated CR-CSCs. Mice were treated for 4 weeks (6–9 weeks) with vehicle, oxaliplatin/5-FU (oxa/5-FU) and BMP7v alone or in combination. Error bars show the mean ± SD of tumor size measured in six mice/group. Black arrowheads indicate days of treatment. i Immunohistochemical analysis of CD44v6, β-catenin, Ki67, and CK20 (red color) in paraffin-embedded sections of CSC#7 xenografts treated as in h . Nuclei were counterstained by aqueous hematoxylin (blue color). The scale bar represents 20 µm (left panels). Percentage of CD44v6, β-catenin, Ki67, and CK20 positive cells in paraffin-embedded sections of tumor xenografts treated with vehicle (V), BMP7v (B), oxaliplatin/5-FU (O/F), alone or in combination (B/O/F) for 72 h. Error bars are mean ± SD of positive cell counts in three serial embedded-paraffin sections of six tumor xenografts per group derived from the injection of three different CRC sphere cells (CSC#1, 2, and 7) (right panels)

Journal: Oncogene

Article Title: Targeting chemoresistant colorectal cancer via systemic administration of a BMP7 variant

doi: 10.1038/s41388-019-1047-4

Figure Lengend Snippet: BMP7v exerts antiangiogenic effects and sensitizes chemoresistant CSCs to standard therapy. a Azan-Mallory staining on paraffin-embedded sections of xenografts derived from the injection of CRC sphere cells and treated for 4 weeks (6–9 weeks) with PBS (vehicle) or BMP7v. Data are representative of three independent experiments using different CRC sphere cell lines (CSC#2, 7, and 18). b Percentage of necrosis evaluated on paraffin-embedded sections of xenografts treated as in a . Data are shown as mean ± SD of three independent experiments. c Immunohistochemical analysis of CD31 and VEGFR2 (red staining) on paraffin-embedded sections of xenografts generated by the injection of CRC sphere cell lines and treated with PBS (vehicle), BMP4, or BMP7v. Green arrowheads indicate microvessels expressing CD31 or VEGFR2. Images are representative of three independent experiments using cells as in a . Nuclei were revealed by hematoxylin staining (blue). The scale bar represents 20 µm. d Number of microvessels positive for CD31 (left panel) and VEGFR2 (right panel) expression, evaluated on paraffin-embedded sections of xenografts treated as in c . Data are shown as mean ± SD of cells. MVD = microvessel density. e Fold change of viable cells in 35 CR-CSC lines treated with oxaliplatin/5-FU for 24 h. Dotted line indicates the threshold between chemoresistant (red) and sensitive CR-CSCs (green). f Cell viability percentage in chemoresistant CR-CSCs (R1-R4) pretreated with BMP7 for 3 days and with oxaliplatin/5-FU (oxa/5-FU) for additional 24 h as indicated. Data are shown as mean ± SD of three different experiments performed in the indicated R-CSCs. g Colony forming efficiency of CR-CSCs treated as in f and evaluated at 21 days. Representative soft-agar analyses are reported in the lower part of the graph. Bars show the mean ± SD of seven different CRC sphere cell lines (CSC#1–3, 5, 7, 10, and 18). h Tumor size of subcutaneous growth of the indicated CR-CSCs. Mice were treated for 4 weeks (6–9 weeks) with vehicle, oxaliplatin/5-FU (oxa/5-FU) and BMP7v alone or in combination. Error bars show the mean ± SD of tumor size measured in six mice/group. Black arrowheads indicate days of treatment. i Immunohistochemical analysis of CD44v6, β-catenin, Ki67, and CK20 (red color) in paraffin-embedded sections of CSC#7 xenografts treated as in h . Nuclei were counterstained by aqueous hematoxylin (blue color). The scale bar represents 20 µm (left panels). Percentage of CD44v6, β-catenin, Ki67, and CK20 positive cells in paraffin-embedded sections of tumor xenografts treated with vehicle (V), BMP7v (B), oxaliplatin/5-FU (O/F), alone or in combination (B/O/F) for 72 h. Error bars are mean ± SD of positive cell counts in three serial embedded-paraffin sections of six tumor xenografts per group derived from the injection of three different CRC sphere cells (CSC#1, 2, and 7) (right panels)

Article Snippet: Following blocking with 3% bovine serum albumin (BSA) for 30 min, cells were exposed overnight at 4 °C to BMP7 (MAB3541, mouse, IgG2 b , R&D system), LGR5 (GPR49, rabbit, IgG, Abgent), CDX2 (MAB3665, mouse, IgG1, R&D Systems), CK20 (NCL-L-CK20, mouse, IgG2 k , Novocastra Leica), E-cadherin (#3195, rabbit, IgG, CST), vimentin (#5741, rabbit, IgG, CST), β-catenin (MAB1329, mouse, IgG2 b , R&D Systems), CD44v6 (BBA13, clone 2F10, mouse, IgG1, R&D system), BMPR1A (MAB2406, mouse, IgG2 b , R&D Systems), BMPR1B (MAB505, mouse, IgG2 a , R&D Systems) and, BMPR2 (MAB811, mouse, IgG2 b , R&D Systems) antibodies or isotype-matched controls (IMCs).

Techniques: Staining, Derivative Assay, Injection, Immunohistochemical staining, Generated, Expressing

BMP7v in combination with PI3K inhibitor hampers tumor growth and reduces the metastatic lesion size. a Immunoblot analysis of PI3K, pAKT, AKT, PTEN, pJNK, JNK, pERK, ERK, and p21 in CD44v6 + and CD44v6 − cells treated with vehicle or BMP7v for 3 days. β-actin was used as loading control. One representative of three independent experiments (CSC#1, 4, and 7) is shown. b Cell viability percentage in R-CSCs treated with vehicle, BMP7v, PI3K inhibitor (PI3Ki), or BMP7v in combination with PI3K inhibitor (BMP7v + PI3Ki) up to 72 h. Data are shown as mean ± SD of three different experiments performed with the indicated R-CSCs. c Tumor size of subcutaneous outgrowth of PIK3CA -mutated xenografts. Mice were treated with vehicle, PI3K inhibitor (PI3Ki), oxaliplatin/5-FU (oxa/5-FU), BMP7v in combination with PI3K inhibitor (BMP7v + PI3Ki) or BMP7 in combination with PI3K inhibitor and oxaliplatin/5-FU (BMP7v + PI3Ki + oxa/5-FU). Data are shown as mean ± SD of tumor size of six mice/group using CSC#1, 18, and 25. Red arrows indicate the start and the end (from 6 to 9 weeks) of treatments. d Kinetics of metastasis formation detected by in vivo imaging analysis at the indicated time following spleen injection of CSC#1, 18, and 25 treated with vehicle, BMP7v, PI3K inhibitor (PI3Ki), or BMP7v in combination with PI3K inhibitor (BMP7v + PI3Ki) for 4 weeks. Black arrows indicate the start and end of treatments (from 4 to 7 weeks). Data are expressed as mean ± SD of six mice analyzed. e In vivo whole-body imaging analysis of mice treated as in d and analyzed at the indicated time points after splenectomy. f Photons count of all metastatic sites (liver, lung, and intestine) in mice treated as in d . Error bars are reported as mean ± SD of the xenografts analyzed as in d (upper panel). Representative in vivo imaging analysis of metastatic foci in the liver, lung, and intestine of mice treated as indicated (lower panels). g Immunofluorescence analysis of CD44v6 (red color) and TUNEL (green color) in paraffin-embedded sections of lung metastasis generated by the injection of CSC#25 in mice treated with vehicle or BMP7v + PI3K inhibitor (BMP7v + PI3Ki). White arrowheads indicate CD44v6 + /Tunel + CRC cells. Nuclei were counterstained with Toto-3 (blue color). Positive control was performed treating cells with DNase. The scale bars represent 20 µm. h Percentage of CD44v6 + /Tunel + cells of lung metastasis treated with vehicle or BMP7v + PI3K inhibitor (BMP7v + PI3Ki). Data are mean ± SD of xenografts derived from injection of three different cell lines (CSC#1, 18, and 25)

Journal: Oncogene

Article Title: Targeting chemoresistant colorectal cancer via systemic administration of a BMP7 variant

doi: 10.1038/s41388-019-1047-4

Figure Lengend Snippet: BMP7v in combination with PI3K inhibitor hampers tumor growth and reduces the metastatic lesion size. a Immunoblot analysis of PI3K, pAKT, AKT, PTEN, pJNK, JNK, pERK, ERK, and p21 in CD44v6 + and CD44v6 − cells treated with vehicle or BMP7v for 3 days. β-actin was used as loading control. One representative of three independent experiments (CSC#1, 4, and 7) is shown. b Cell viability percentage in R-CSCs treated with vehicle, BMP7v, PI3K inhibitor (PI3Ki), or BMP7v in combination with PI3K inhibitor (BMP7v + PI3Ki) up to 72 h. Data are shown as mean ± SD of three different experiments performed with the indicated R-CSCs. c Tumor size of subcutaneous outgrowth of PIK3CA -mutated xenografts. Mice were treated with vehicle, PI3K inhibitor (PI3Ki), oxaliplatin/5-FU (oxa/5-FU), BMP7v in combination with PI3K inhibitor (BMP7v + PI3Ki) or BMP7 in combination with PI3K inhibitor and oxaliplatin/5-FU (BMP7v + PI3Ki + oxa/5-FU). Data are shown as mean ± SD of tumor size of six mice/group using CSC#1, 18, and 25. Red arrows indicate the start and the end (from 6 to 9 weeks) of treatments. d Kinetics of metastasis formation detected by in vivo imaging analysis at the indicated time following spleen injection of CSC#1, 18, and 25 treated with vehicle, BMP7v, PI3K inhibitor (PI3Ki), or BMP7v in combination with PI3K inhibitor (BMP7v + PI3Ki) for 4 weeks. Black arrows indicate the start and end of treatments (from 4 to 7 weeks). Data are expressed as mean ± SD of six mice analyzed. e In vivo whole-body imaging analysis of mice treated as in d and analyzed at the indicated time points after splenectomy. f Photons count of all metastatic sites (liver, lung, and intestine) in mice treated as in d . Error bars are reported as mean ± SD of the xenografts analyzed as in d (upper panel). Representative in vivo imaging analysis of metastatic foci in the liver, lung, and intestine of mice treated as indicated (lower panels). g Immunofluorescence analysis of CD44v6 (red color) and TUNEL (green color) in paraffin-embedded sections of lung metastasis generated by the injection of CSC#25 in mice treated with vehicle or BMP7v + PI3K inhibitor (BMP7v + PI3Ki). White arrowheads indicate CD44v6 + /Tunel + CRC cells. Nuclei were counterstained with Toto-3 (blue color). Positive control was performed treating cells with DNase. The scale bars represent 20 µm. h Percentage of CD44v6 + /Tunel + cells of lung metastasis treated with vehicle or BMP7v + PI3K inhibitor (BMP7v + PI3Ki). Data are mean ± SD of xenografts derived from injection of three different cell lines (CSC#1, 18, and 25)

Article Snippet: Following blocking with 3% bovine serum albumin (BSA) for 30 min, cells were exposed overnight at 4 °C to BMP7 (MAB3541, mouse, IgG2 b , R&D system), LGR5 (GPR49, rabbit, IgG, Abgent), CDX2 (MAB3665, mouse, IgG1, R&D Systems), CK20 (NCL-L-CK20, mouse, IgG2 k , Novocastra Leica), E-cadherin (#3195, rabbit, IgG, CST), vimentin (#5741, rabbit, IgG, CST), β-catenin (MAB1329, mouse, IgG2 b , R&D Systems), CD44v6 (BBA13, clone 2F10, mouse, IgG1, R&D system), BMPR1A (MAB2406, mouse, IgG2 b , R&D Systems), BMPR1B (MAB505, mouse, IgG2 a , R&D Systems) and, BMPR2 (MAB811, mouse, IgG2 b , R&D Systems) antibodies or isotype-matched controls (IMCs).

Techniques: Western Blot, Control, In Vivo Imaging, Injection, In Vivo, Imaging, Immunofluorescence, TUNEL Assay, Generated, Positive Control, Derivative Assay

Schematic model of BMP7v effects in primary and metastatic CRC. a In primary tumor the colon cancer crypt organization, which is physiologically maintained by BMPs/BMP inhibitor balance, is disrupted. The administration of BMP7v selectively counteracts the expansion of the CSC compartment by reducing CD44v6 expression. Moreover, BMP inhibitors (noggin, gremlin, and others), produced by myofibroblasts, are not able to inhibit BMP7v activity on promoting the differentiation of CSCs (upper panel). In metastatic tumor, BMP7v in combination with PI3K inhibitors reduces the number of CD44v6 + cells and hampers the tumor metastatic growth (bottom panel). CSC cancer stem cell, DCC differentiated cancer cell, DC differentiated cell

Journal: Oncogene

Article Title: Targeting chemoresistant colorectal cancer via systemic administration of a BMP7 variant

doi: 10.1038/s41388-019-1047-4

Figure Lengend Snippet: Schematic model of BMP7v effects in primary and metastatic CRC. a In primary tumor the colon cancer crypt organization, which is physiologically maintained by BMPs/BMP inhibitor balance, is disrupted. The administration of BMP7v selectively counteracts the expansion of the CSC compartment by reducing CD44v6 expression. Moreover, BMP inhibitors (noggin, gremlin, and others), produced by myofibroblasts, are not able to inhibit BMP7v activity on promoting the differentiation of CSCs (upper panel). In metastatic tumor, BMP7v in combination with PI3K inhibitors reduces the number of CD44v6 + cells and hampers the tumor metastatic growth (bottom panel). CSC cancer stem cell, DCC differentiated cancer cell, DC differentiated cell

Article Snippet: Following blocking with 3% bovine serum albumin (BSA) for 30 min, cells were exposed overnight at 4 °C to BMP7 (MAB3541, mouse, IgG2 b , R&D system), LGR5 (GPR49, rabbit, IgG, Abgent), CDX2 (MAB3665, mouse, IgG1, R&D Systems), CK20 (NCL-L-CK20, mouse, IgG2 k , Novocastra Leica), E-cadherin (#3195, rabbit, IgG, CST), vimentin (#5741, rabbit, IgG, CST), β-catenin (MAB1329, mouse, IgG2 b , R&D Systems), CD44v6 (BBA13, clone 2F10, mouse, IgG1, R&D system), BMPR1A (MAB2406, mouse, IgG2 b , R&D Systems), BMPR1B (MAB505, mouse, IgG2 a , R&D Systems) and, BMPR2 (MAB811, mouse, IgG2 b , R&D Systems) antibodies or isotype-matched controls (IMCs).

Techniques: Expressing, Produced, Activity Assay

Endogenous IFI16 inhibits HIV-1 in primary CD4 + T lymphocytes. Cells from three healthy donors were isolated and activated with IL-2 and anti-CD3/CD28 beads. 72 hours post-activation, cells were transfected with Cas9 in complex with either a non-targeting (nt) or an IFI16-specific gRNA. At 96 hours post-transfection, cells were transduced with the indicated VSV-G pseudotyped HIV-1 strains. (A-D) The reduction of IFI16 protein levels in infected cell cultures (A), the infectious virus yield (B), p24 antigen production (C) and levels of viral RNA transcripts (D) were determined by Western blot, TZM-bl infection assay, ELISA and qRT-PCR, respectively, three days post infection. Bar diagrams in panel A and D show mean values (±SD) of the three different donors; those in panel B and C from triplicate measurements. Numbers above bars indicate n-fold change between cells treated with control or IFI16 specific gRNA. * p <0.05, ** p <0.01, *** p <0.001. (E) Association of Sp1 and IFI16 by in situ PLA. (F) Sp1 co-precipitates with IFI16 and PYHIN in CD4 + T lymphocytes. Cells from three healthy donors were isolated and activated with IL-2 and anti-CD3/CD28 beads. 72 hours post activation, cells were lysed and endogenous Sp1 was immunoprecipitated using magnetic beads coated with either an Sp1 antibody or control IgG. Co-IP eluates and input controls were subsequently analysed by Western Blotting. Shown is the blot of one representative experiment. On the right-hand panel, the IFI16 signal intensity from three independent experiment (±SEM) is shown.

Journal: PLoS Pathogens

Article Title: Nuclear PYHIN proteins target the host transcription factor Sp1 thereby restricting HIV-1 in human macrophages and CD4+ T cells

doi: 10.1371/journal.ppat.1008752

Figure Lengend Snippet: Endogenous IFI16 inhibits HIV-1 in primary CD4 + T lymphocytes. Cells from three healthy donors were isolated and activated with IL-2 and anti-CD3/CD28 beads. 72 hours post-activation, cells were transfected with Cas9 in complex with either a non-targeting (nt) or an IFI16-specific gRNA. At 96 hours post-transfection, cells were transduced with the indicated VSV-G pseudotyped HIV-1 strains. (A-D) The reduction of IFI16 protein levels in infected cell cultures (A), the infectious virus yield (B), p24 antigen production (C) and levels of viral RNA transcripts (D) were determined by Western blot, TZM-bl infection assay, ELISA and qRT-PCR, respectively, three days post infection. Bar diagrams in panel A and D show mean values (±SD) of the three different donors; those in panel B and C from triplicate measurements. Numbers above bars indicate n-fold change between cells treated with control or IFI16 specific gRNA. * p <0.05, ** p <0.01, *** p <0.001. (E) Association of Sp1 and IFI16 by in situ PLA. (F) Sp1 co-precipitates with IFI16 and PYHIN in CD4 + T lymphocytes. Cells from three healthy donors were isolated and activated with IL-2 and anti-CD3/CD28 beads. 72 hours post activation, cells were lysed and endogenous Sp1 was immunoprecipitated using magnetic beads coated with either an Sp1 antibody or control IgG. Co-IP eluates and input controls were subsequently analysed by Western Blotting. Shown is the blot of one representative experiment. On the right-hand panel, the IFI16 signal intensity from three independent experiment (±SEM) is shown.

Article Snippet: Alternatively, 1*10 6 cells were transfected with the HiFi Cas9 Nuclease V3 (IDT)/gRNA complex (80 pmol/300 pml) (Lonza) using a non-targeting (IDT (ACGGAGGCTAAGCGTCGCAA)) or an IFI16-specific (IDT (GACCAGCCCTATCAAGAAAG)) sgRNAs, using the Amaxa 4D-Nucleofector Human Activated T Cell P3 Lonza Kit (Lonza), pulse code EO115.

Techniques: Isolation, Activation Assay, Transfection, Transduction, Infection, Virus, Western Blot, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR, Control, In Situ, Immunoprecipitation, Magnetic Beads, Co-Immunoprecipitation Assay

Analysis of NS5A protein expression for threonine mutants. Huh7 cells were electroporated with in vitro transcripts of either (a) mSGR-luc-JFH-1 or (b) mJFH-1 containing the indicated mutants, cells were lysed at 48 hpe and analysed by Western blot with sheep polyclonal anti-NS5A serum or anti-actin as the loading control. Western blots were quantified using Image Studio v3.1 (LI-COR). Data from three independent experiments are shown and error bars represent the standard error of the mean.

Journal: The Journal of General Virology

Article Title: Regulation of hepatitis C virus replication via threonine phosphorylation of the NS5A protein

doi: 10.1099/jgv.0.000975

Figure Lengend Snippet: Analysis of NS5A protein expression for threonine mutants. Huh7 cells were electroporated with in vitro transcripts of either (a) mSGR-luc-JFH-1 or (b) mJFH-1 containing the indicated mutants, cells were lysed at 48 hpe and analysed by Western blot with sheep polyclonal anti-NS5A serum or anti-actin as the loading control. Western blots were quantified using Image Studio v3.1 (LI-COR). Data from three independent experiments are shown and error bars represent the standard error of the mean.

Article Snippet: Quantification of Western blots was carried out using Image Studio v3.1 (LI-COR) using a background subtraction method.

Techniques: Expressing, In Vitro, Western Blot